LAUSR

Dear Editor, The Coronavirus disease 2019 (COVID-19) pandemic is one of the most serious global public health crises to date. As of July 12, 2020, more than 12.6 million cases of COVID-19 infection with 0.56 million deaths were confirmed worldwide. Since there are no effective therapeutics to treat severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2, the causative virus of COVID-19) infection so far, the pandemic is rapidly spreading worldwide. It is urgent to develop effective therapies, not only to treat infected patients but also to control the pandemic. Our previous studies have demonstrated that a plant microRNA, MIR2911, which is enriched in honeysuckle decoction (HD), directly targets influenza A viruses (IAV), including H1N1, H5N1, and H7N9 subtypes by binding to their mRNA and blocking protein translation. Oral administration of HD can prevent IAV infection and reduce H5N1-induced mouse death. Subsequent studies have shown that MIR2911 also directly inhibits the replication of various viruses in addition to IAVs. Upon dietary uptake, these microRNAs self-assemble into exosomes and are then secreted into the circulation and delivered into target tissues or specific cells, including the liver, lung, spleen, pancreas, and T cells. Given the unique GC-enriched nucleotide composition of MIR2911 (GGCCGGGGGACGGACUGGGA) and after we analyzed the genome sequence of SARS-CoV-2, it is most likely that the virus genome contains MIR2911-binding sites and that MIR2911 can inhibit SARS-CoV-2 replication directly. In the present study, we assessed the inhibitory effect of absorbed MIR2911 in HD on SARS-CoV-2 replication and conducted a clinical study to investigate the efficacy of HD in COVID-19 patients. By using bioinformatics analysis, we predicted that there are 179 putative MIR2911-binding sites in the SARSCoV-2 genome. Twenty-eight binding sites (Supplementary Table S1) were confirmed by classic luciferase assay (Supplementary Fig. S1), which are distributed widely in the virus genome (Fig. 1a), indicating that MIR2911 may be able to inhibit the translation of almost all the proteins of SARS-CoV-2. In order to assess the direct effect of absorbed MIR2911 on SARS-CoV-2 replication, cellular exosomes were collected from culture medium of HEK293T cells transfected with synthetic MIR2911 or control non-coding RNA (ncRNA), as similar method to previous report (Fig. 1b). Isolated cellular exosomes with/without MIR2911 were separately pre-incubated with 5 × 10 Vero E6 cells (ATCC1586) in 0.25ml cell medium for 8 h. After changing the culture medium, the cells were infected with SARS-CoV-2 (nCoV-2019BetaCoV/Wuhan/WIV04/2019) at a multiplicity of infection (MOI) of 0.01. Efficacies were evaluated by quantification of viral copy numbers in the cell supernatant via quantitative real-time RT-PCR (qRT-PCR) at 24 h post infection (p.i.) (Fig. 1b). As shown in Fig. 1c,