LAUSR

MiR-126 is a highly preserved, non-coding RNA that is expressed primarily in human endothelial cells and is a key regulator of angiogenesis and vasculogenesis. MiR-126 is found in human genomes within intron 7 of the gene Epidermal Growth Factor-Like Domain 7 (EGFL7) on chromosome 9. Pre-MiR-126 processing, i.e., the miRNA precursor, produces two mature strands: (a) MiR-126-3p with the sequence: UCGUACCGUAGUAAUAAUGCG and (b) MiR-126-5p with the sequence: CAUUAUUACUUUUGGUACGCG. In the eye, by regulating the expression of VCAM1 (Vascular Cell Adhesion Molecule 1) and the pro-apoptotic marker BCL2L11 (B-Cell Lymphoma 2-Like 11), MiR-126 maintains the integrity of the Blood-Retina-Barrier (BRB). MiR-126 protects against apoptosis of retinal endothelial cells, retinal vascular leakage, and retinal permeability under ischemic conditions in the retina. Furthermore, MiR-126 protects Muller cells against hypoxic retinal damage. Mature blood vessels express abundant levels of MiR-126, which controls the signaling cascades of VEGFand Angiopoietin, thus regulating angiogenesis and vasculature development.