LAUSR

Obesity has become a serious issue due to its worldwide prevalence and is the leading risk factor for other metabolic diseases. Increasing evidence indicates that the activation and recruitment of brown adipose tissue (BAT) and the induction of the expression of uncoupling protein 1 (UCP1) are attractive strategies to increase metabolic efficiency and counteract weight gain [1]. UCP1, a thermogenic protein, is located in the inner mitochondrial membrane, is mainly expressed in brown and beige/brite adipose tissues and plays critical roles in metabolic and energy balance by releasing chemical energy as heat [2]. Furthermore, the activity of the UCP1 promoter has been shown to be activated during the browning of white adipose tissue (WAT) and is generally inactivated in tissues except brown and beige/brite adipose tissues [3]. Therefore, targeting the activity of the UCP1 gene promoter might be a promising strategy to regulate the expression of UCP1. G-quadruplexes are nucleic acid secondary structures formed in Grich sequences in DNA or RNA, which include single nucleic acid strands (unimolecular G-quadruplex, Uni-G4), between strands (bimolecular G-quadruplex, Bi-G4), and tetramolecular quadruplexes (tetra-G4). G-quadruplexes have become promising therapeutic targets due to their roles in the expressions of many critical genes. There is a G-quadruplex-forming sequence in the promoter of the UCP1 gene, andmutation in the G-quadruplex sequence dramatically enhances the activity of the UCP1 gene promoter, suggesting that the G-quadruplex is a potential target to regulate UCP1 expression [4]. Berberine has been shown to induce the development of beige/ brite adipocytes by increasing the expression of UCP1 and proved to have metabolic benefits by increasing energy expenditure and limiting weight gain in obese and/or db/db mice [5,6]. Although the roles of transcription cascades and epigenetics in the regulation of the activity of the UCP1 gene promoter have been widely reported, it is not clear whether berberine affects the activity of the UCP1 gene promoter and its associated mechanisms. In this study, we characterized the effects of berberine on the Gquadruplex formed by the oligonucleotide fragment of the UCP1 gene promoter (Olig) using a variety of spectroscopic techniques (UV‒visible, fluorescence, and circular dichroism) and native gel electrophoresis approaches. We also determined the influence of berberine on the expression of the UPC1 gene and the biosynthesis of fatty acids in differentiated 3T3-L1 adipocytes. The oligonucleotide fragment of the UCP1 gene promoter (CGAGGGTGGGTAGGAGGGGACGCGGGGACT, Olig) and its G→A mutated sequence (CGAGGGTAAATAGGAAAAAACGCAAAAACT, muOlig) were synthesized by Sangon Biotech (Shanghai, China), dissolved in double-distilled water, and prepared in 10 mM Tris-HCl buffer (pH 7.4). After the DNA samples were heated to 95°C for 5 min, the indicated dosages of berberine and/or KCl were mixed with the DNA samples before the DNA was slowly cooled to room temperature. Absorption spectroscopy was recorded using a Shimazu 2450 UV‒vis spectrophotometer at 25°C from 280 to 550 nm. As shown in Figure 1A, there were two distinct peaks of berberine solution at 340 and 420 nm; the addition of quadruplex caused a significant hypochromicity (approximately 45%) and a moderate bathochromic shift of 8 nm for the high-energy peak from 340 to 348 nm and hyperchromicity with a redshift of 50 nm for the low-energy peak from 420 to 470 nm. These data suggest that berberine binding with oligonucleotide fragments results in hypochromicity and bathochromism through a strong intercalation between berberine and the G-quadruplex. At the same time, fluorescence spectroscopy was performed on a fluorescence spectrometer (Thermo Fisher Scientific, Waltham, USA) from 450 to 700 nm at an excitation wavelength of 280 nm at 25°C, and the excitation and emission slit widths were set as 5 and 10 nm, respectively. As shown in Figure 1B, berberine alone in Tris buffer was nonfluorescent, but in the presence of G-quadruplexes, the fluorescence intensity of berberine was increased dramatically, and the λmax in the fluorescence emission spectra shifted to the blue end by 8 nm. Moreover, the effect of berberine on the conformation of the G-quadruplex formed by Olig was further evidenced by CD spectroscopy, which was recorded on a spectropolarimeter (CHIRASCAN; Applied Photphysics Ltd, Leatherhead, UK) from 200 to 350 nm at 25°C in a 0.1 cm path length quartz cell at a scanning rate