Enantioselective sulfoxidation using Streptomyces glaucescens GLA.0
Sign Up to like & getrecommendations! Published in 2020 at "RSC Advances"
DOI: 10.1039/d0ra05838f
Abstract: Asymmetric oxidation of prochiral sulfides is a direct means for production of enantiopure sulfoxides which are important in organic synthesis and the pharmaceutical industry. In the present study, Streptomyces glaucescens GLA.0 was employed for stereoselective… read more here.
Keywords: sulfoxidation using; enantioselective sulfoxidation; using streptomyces; glaucescens gla ... See more keywords
Discovering New G-Quadruplex DNA Catalysts in Enantioselective Sulfoxidation Reaction
Sign Up to like & getrecommendations! Published in 2022 at "International Journal of Molecular Sciences"
DOI: 10.3390/ijms23031092
Abstract: The natural human telomeric G-quadruplex (G4) sequence d(GGGTTAGGGTTAGGGTTAGGG) HT21 was extensively utilized as a G4 DNA-based catalytic system for enantioselective reactions. Nine oligonucleotides (ODNs) based on this sequence and containing 8-bromo-2′-deoxyadenosine (ABr), 8-oxo-2′-deoxyadenosine (Aoxo) or… read more here.
Keywords: dna; enantioselective sulfoxidation; reaction; sulfoxidation reaction ... See more keywords