Highly efficient genome editing by homology-directed repair using Cas9 protein in Ceratitis capitata.
Sign Up to like & getrecommendations! Published in 2018 at "Insect biochemistry and molecular biology"
DOI: 10.1016/j.ibmb.2018.08.004
Abstract: The Mediterranean fruit fly Ceratitis capitata is a highly polyphagous and invasive insect pest, causing enormous economic damage in horticultural systems. A successful and environment-friendly control strategy is the sterile insect technique (SIT) that reduces… read more here.
Keywords: protein; genome editing; capitata; homology directed ... See more keywords
Generation of chromosomal translocations that lead to conditional fusion protein expression using CRISPR-Cas9 and homology-directed repair.
Sign Up to like & getrecommendations! Published in 2017 at "Methods"
DOI: 10.1016/j.ymeth.2017.05.006
Abstract: Recurrent chromosomal translocations often lead to expression of fusion proteins associated with oncogenic transformation. To study translocations and downstream events, genome editing techniques have been developed to generate chromosomal translocations through non-homologous end joining of… read more here.
Keywords: directed repair; chromosomal translocations; crispr cas9; homology directed ... See more keywords
Self-inactivating, all-in-one AAV vectors for precision Cas9 genome editing via homology-directed repair in vivo
Sign Up to like & getrecommendations! Published in 2021 at "Nature Communications"
DOI: 10.1038/s41467-021-26518-y
Abstract: Adeno-associated virus (AAV) vectors are important delivery platforms for therapeutic genome editing but are severely constrained by cargo limits. Simultaneous delivery of multiple vectors can limit dose and efficacy and increase safety risks. Here, we… read more here.
Keywords: genome editing; directed repair; homology directed; aav vectors ... See more keywords
Nanoparticle delivery of Cas9 ribonucleoprotein and donor DNA in vivo induces homology-directed DNA repair
Sign Up to like & getrecommendations! Published in 2017 at "Nature biomedical engineering"
DOI: 10.1038/s41551-017-0137-2
Abstract: Clustered regularly interspaced short palindromic repeats (CRISPR)–CRISPR associated protein 9 (Cas9)-based therapeutics, especially those that can correct gene mutations via homology-directed repair, have the potential to revolutionize the treatment of genetic diseases. However, it is… read more here.
Keywords: donor dna; cas9 ribonucleoprotein; homology directed; dna ... See more keywords
Understanding the diversity of genetic outcomes from CRISPR-Cas generated homology-directed repair
Sign Up to like & getrecommendations! Published in 2019 at "Communications Biology"
DOI: 10.1038/s42003-019-0705-y
Abstract: As CRISPR-Cas systems advance toward clinical application, it is essential to identify all the outcomes of gene-editing activity in human cells. Reports highlighting the remarkable success of homology-directed repair (HDR) in the treatment of inherited… read more here.
Keywords: directed repair; crispr cas; homology directed; homology ... See more keywords
Homology-directed repair in mouse cells increased by CasRx-mediated knockdown or co-expressing Kaposi’s sarcoma-associated herpesvirus ORF52
Sign Up to like & getrecommendations! Published in 2019 at "Bioscience Reports"
DOI: 10.1042/bsr20191914
Abstract: Abstract Precise genome editing with directed base insertion or targeted point mutations can be achieved by CRISPR/Cas9-mediated homology-directed repair (HDR) and is of great significance in clinical disease therapy. However, HDR efficiency, compared with non-homologous… read more here.
Keywords: sarcoma associated; kaposi sarcoma; associated herpesvirus; directed repair ... See more keywords
Homology-Directed Repair by CRISPR-Cas9 Mutagenesis in Xenopus Using Long Single-Stranded Donor DNA Templates via Simple Microinjection of Embryos.
Sign Up to like & getrecommendations! Published in 2022 at "Cold Spring Harbor protocols"
DOI: 10.1101/pdb.prot107599
Abstract: We describe a step-by-step procedure to perform homology-directed repair (HDR)-mediated precise gene editing in Xenopus embryos using long single-stranded DNA (lssDNA) as a donor template for HDR in conjunction with the CRISPR-Cas9 system. A key… read more here.
Keywords: using long; long single; single stranded; xenopus ... See more keywords
Precise in planta genome editing via homology‐directed repair in wheat
Sign Up to like & getrecommendations! Published in 2022 at "Plant Biotechnology Journal"
DOI: 10.1111/pbi.13984
Abstract: ATGGTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCATCCTGGTCGAGCTGGACGGCGACGTAAACGGCCACAAGTTCAGCGTG TCCGGCGAGGGCGAGGGCGATGCCACCTACGGCAAGCTGACCCTGAAGTTCATCTGCACCACCGGCAAGCTGCCCGTGCCCTGGCCCACC CTCGTGACCACCTTCACCTACGGCGTGCAGTGCTTCAGCCGCTACCCCGACCACATGAAGCAGCACGACTTCTTCAAGTCCGCCATGCCC GAAGGCTACGTCCAGGAGCGCACCATCTTCTTCAAGGACGACGGCAACTACAAGACCCGCGCCGAGGTGAAGTTCGAGGGCGACACCCTG GTGAACCGCATCGAGCTGAAGGGCATCGACTTCAAGGAGGACGGCAACATCCTGGGGCACAAGCTGGAGTACAACTACAACAGCCACAAC GTCTATATCATGGCCGACAAGCAGAAGAACGGCATCAAGGTGAACTTCAAGATCCGCCACAACATCGAGGACGGCAGCGTGCAGCTCGCC GACCACTACCAGCAGAACACCCCCATCGGCGACGGCCCCGTGCTGCTGCCCGACAACCACTACCTGAGCACCCAGTCCGCCCTGAGCAAA GACCCCAACGAGAAGCGCGATCACATGGTCCTGCTGGAGTTCGTGACCGCCGCCGGGATCACTCACGGCATGGACGAGCTGTACAAGTAA TaSD1_D: dsDonor: read more here.
Keywords: genome editing; via homology; precise planta; planta genome ... See more keywords
GRB2 enforces homology-directed repair initiation by MRE11
Sign Up to like & getrecommendations! Published in 2021 at "Science Advances"
DOI: 10.1126/sciadv.abe9254
Abstract: GRB2 controls radiation-induced DNA damage repair—a predictive biomarker for PARPi and radiation therapy outcome. DNA double-strand break (DSB) repair is initiated by MRE11 nuclease for both homology-directed repair (HDR) and alternative end joining (Alt-EJ). Here,… read more here.
Keywords: directed repair; hdr; homology directed; grb2 ... See more keywords
Dipeptide repeat proteins inhibit homology-directed DNA double strand break repair in C9ORF72 ALS/FTD
Sign Up to like & getrecommendations! Published in 2020 at "Molecular Neurodegeneration"
DOI: 10.1186/s13024-020-00365-9
Abstract: Background The C9ORF72 hexanucleotide repeat expansion is the most common known genetic cause of amyotrophic lateral sclerosis (ALS) and frontotemporal dementia (FTD), two fatal age-related neurodegenerative diseases. The C9ORF72 expansion encodes five dipeptide repeat proteins… read more here.
Keywords: repair pathways; dna; homology directed; dna dsb ... See more keywords
The Pathogenic R3052W BRCA2 Variant Disrupts Homology-Directed Repair by Failing to Localize to the Nucleus
Sign Up to like & getrecommendations! Published in 2022 at "Frontiers in Genetics"
DOI: 10.3389/fgene.2022.884210
Abstract: The BRCA2 germline missense variant, R3052W, resides in the DNA binding domain and has been previously classified as a pathogenic allele. In this study, we sought to determine how R3052W alters the cellular functions of… read more here.
Keywords: brca2; variant; r3052w; homology directed ... See more keywords