Articles with "mir 26b" as a keyword



MiR-26b-5p mediates radioresistance and immunosuppression via targeting PRKCD in non-small cell lung cancer

Sign Up to like & get
recommendations!
Published in 2025 at "Journal of Cancer Research and Clinical Oncology"

DOI: 10.1007/s00432-025-06310-x

Abstract: Overcoming miRNA-mediated radioresistance and enhancing its synergy with immunotherapy remained significant challenges. A total of 23 patients with locally advanced non-small cell lung cancer (NSCLC) undergoing thoracic radiotherapy from a single center were enrolled. Pre-radiotherapy… read more here.

Keywords: cancer; non small; radiotherapy; cell ... See more keywords

Long non-coding RNA 520 is a negative prognostic biomarker and exhibits pro-oncogenic function in nasopharyngeal carcinoma carcinogenesis through regulation of miR-26b-3p/USP39 axis.

Sign Up to like & get
recommendations!
Published in 2019 at "Gene"

DOI: 10.1016/j.gene.2019.02.093

Abstract: Long non-coding RNAs (lncRNAs) have been wildly verified to modulate multiple tumorigenesis, especially nasopharyngeal carcinoma (NPC). In present study, we aims to investigate the role and mechanism of LINC00520 in the NPC carcinogenesis. Results indicated… read more here.

Keywords: long non; non coding; mir 26b; linc00520 ... See more keywords

Long noncoding RNA Malat1 is a potent autophagy inducer protecting brain microvascular endothelial cells against oxygen-glucose deprivation/reoxygenation-induced injury by sponging miR-26b and upregulating ULK2 expression

Sign Up to like & get
recommendations!
Published in 2017 at "Neuroscience"

DOI: 10.1016/j.neuroscience.2017.04.017

Abstract: Brain microvascular endothelial cell (BMEC) injury induced by ischemia-reperfusion (I/R) is the initial stage of blood-brain barrier (BBB) disruption, which results in a poor prognosis in ischemic stroke patients. Autophagy has been shown to have… read more here.

Keywords: bmec autophagy; malat1; mir 26b; expression ... See more keywords

LncRNA SNHG5 upregulation induced by YY1 contributes to angiogenesis via miR-26b/CTGF/VEGFA axis in acute myelogenous leukemia

Sign Up to like & get
recommendations!
Published in 2020 at "Laboratory Investigation"

DOI: 10.1038/s41374-020-00519-9

Abstract: Acute myelogenous leukemia (AML) is the most common acute leukemia in adults. Despite great progress has been made in this field, the pathogenesis of AML is still not fully understood. We report here the biological… read more here.

Keywords: myelogenous leukemia; mir 26b; aml; acute myelogenous ... See more keywords
Photo from academic.microsoft.com

Retracted Article: Upregulation of miR-26b alleviates morphine tolerance by inhibiting BDNF via Wnt/β-catenin pathway in rats

Sign Up to like & get
recommendations!
Published in 2019 at "RSC Advances"

DOI: 10.1039/c9ra06264e

Abstract: Morphine is a commonly used analgesic drug. However, long-term use of morphine will cause tolerance which limits its clinical application in pain treatment. read more here.

Keywords: tolerance; upregulation mir; retracted article; mir 26b ... See more keywords

Interactions between achiral porphyrins and a mature miRNA.

Sign Up to like & get
recommendations!
Published in 2024 at "Nanoscale"

DOI: 10.1039/d3nr05504c

Abstract: Recent discoveries have revealed that mature miRNAs could form highly ordered structures similar to aptamers, suggesting diverse functions beyond mRNA recognition and degradation. This study focuses on understanding the secondary structures of human miR-26b-5p (UUCAAGUAAUUCAGGAUAGGU)… read more here.

Keywords: porphyrins mature; porphyrin; chiroptical probes; mir 26b ... See more keywords

Magnesium isoglycyrrhizinate suppresses bladder cancer progression by modulating the miR-26b/Nox4 axis

Sign Up to like & get
recommendations!
Published in 2022 at "Bioengineered"

DOI: 10.1080/21655979.2022.2031677

Abstract: ABSTRACT Magnesium isoglycyrrhizinate (MI), a magnesium salt of 18α-GA stereoisomer, has been reported to exert efficient hepatoprotective activity. However, its effect on bladder cancer remains unclear. The study explored the effects of MI on the… read more here.

Keywords: magnesium isoglycyrrhizinate; mir 26b; bladder cancer; modulating mir ... See more keywords

Circular RNA_ANKIB1 accelerates chemo-resistance of osteosarcoma via binding microRNA-26b-5p and modulating enhancer of zeste homolog 2

Sign Up to like & get
recommendations!
Published in 2022 at "Bioengineered"

DOI: 10.1080/21655979.2022.2037869

Abstract: ABSTRACT Osteosarcoma is a common bone malignancy in children and adolescents. Chemotherapeutic drug resistance is the major factor impacting the surgical outcome and prognosis of patients with osteosarcoma. This investigation assessed the role and mechanism… read more here.

Keywords: mir 26b; circ ankib1; circular rna; dxr resistant ... See more keywords

miR-26b Promotes 3T3-L1 Adipocyte Differentiation Through Targeting PTEN.

Sign Up to like & get
recommendations!
Published in 2017 at "DNA and cell biology"

DOI: 10.1089/dna.2017.3712

Abstract: microRNAs (miRNAs) play important roles in adipogenesis that is closely linked to obesity and energy homeostasis. Thus far, only a few miRNAs have been identified to regulate adipocyte development, arousing interest in the detailed function… read more here.

Keywords: mir 26b; expression; differentiation; 26b promotes ... See more keywords

MicroRNA-26b Reduces Cell Viability by Inhibition of Nicotinamide Phosphoribosyltransferase in Breast Cancer Cells.

Sign Up to like & get
recommendations!
Published in 2022 at "DNA and cell biology"

DOI: 10.1089/dna.2022.0214

Abstract: Breast cancer (BC) is one of the most common causes of cancer in women worldwide and it is found to be associated with an increased level of Nicotinamide phosphoribosyltransferase (NAMPT), which plays an important role… read more here.

Keywords: mir 26b; expression; breast cancer; cancer ... See more keywords

miR-26b Inhibits Virus Replication Through Positively Regulating Interferon Signaling.

Sign Up to like & get
recommendations!
Published in 2018 at "Viral immunology"

DOI: 10.1089/vim.2018.0067

Abstract: microRNAs have been reported to play crucial roles in various biological processes, including cell proliferation, apoptosis, tumor genesis, and viral infections. miR-26b has been found to be involved in the pathogenesis of multiple tumors, however,… read more here.

Keywords: 26b inhibits; interferon; inhibits virus; mir 26b ... See more keywords