Articles with "recognition particle" as a keyword



Co-translational Folding Intermediate Dictates Membrane Targeting of the Signal Recognition Particle Receptor.

Sign Up to like & get
recommendations!
Published in 2018 at "Journal of molecular biology"

DOI: 10.1016/j.jmb.2018.04.017

Abstract: Much of our knowledge on the function of proteins is deduced from their mature, folded states. However, it is unknown whether partially synthesized nascent protein segments can execute biological functions during translation and whether their… read more here.

Keywords: signal recognition; membrane targeting; recognition particle; particle receptor ... See more keywords

Identification of a novel bacteriophage attachment site into ffs, the 4.5S non-coding RNA component of the signal recognition particle

Sign Up to like & get
recommendations!
Published in 2025 at "Scientific Reports"

DOI: 10.1038/s41598-025-20531-7

Abstract: Bioinformatic analysis of Enterococcus faecalis temperate phage ϕEf11 identified prospective attP and attB core attachment (att) sites consisting of identical 27 nt sequences (ACTAAGCAAGTGCCGCCATGTGTCTGA). The presumptive attPcore site was located 74 nts from the terminus… read more here.

Keywords: recognition particle; rna component; site; attachment ... See more keywords

Nascent polypeptide-Associated Complex and Signal Recognition Particle have cardiac-specific roles in heart development and remodeling

Sign Up to like & get
recommendations!
Published in 2022 at "PLOS Genetics"

DOI: 10.1371/journal.pgen.1010448

Abstract: Establishing a catalog of Congenital Heart Disease (CHD) genes and identifying functional networks would improve our understanding of its oligogenic underpinnings. Our studies identified protein biogenesis cofactors Nascent polypeptide-Associated Complex (NAC) and Signal-Recognition-Particle (SRP) as… read more here.

Keywords: recognition particle; associated complex; nascent polypeptide; heart ... See more keywords

Anti-signal Recognition Particle Antibody-positive Immune-mediated Myopathy after mRNA-1273 SARS-CoV-2 Vaccination

Sign Up to like & get
recommendations!
Published in 2022 at "Internal Medicine"

DOI: 10.2169/internalmedicine.0404-22

Abstract: A 26-year-old Japanese woman developed a fever, myalgia and gait disturbance one day after receiving the second dose of the mRNA-1273 severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) vaccine. A neurological examination revealed symmetrical weakness… read more here.

Keywords: recognition particle; mrna 1273; anti signal; antibody ... See more keywords

Signal Recognition Particle in Human Diseases

Sign Up to like & get
recommendations!
Published in 2022 at "Frontiers in Genetics"

DOI: 10.3389/fgene.2022.898083

Abstract: The signal recognition particle (SRP) is a ribonucleoprotein complex with dual functions. It co-translationally targets proteins with a signal sequence to the endoplasmic reticulum (ER) and protects their mRNA from degradation. If SRP is depleted… read more here.

Keywords: human diseases; particle human; signal recognition; recognition particle ... See more keywords