Articles with "rna component" as a keyword



Identification of a novel bacteriophage attachment site into ffs, the 4.5S non-coding RNA component of the signal recognition particle

Sign Up to like & get
recommendations!
Published in 2025 at "Scientific Reports"

DOI: 10.1038/s41598-025-20531-7

Abstract: Bioinformatic analysis of Enterococcus faecalis temperate phage ϕEf11 identified prospective attP and attB core attachment (att) sites consisting of identical 27 nt sequences (ACTAAGCAAGTGCCGCCATGTGTCTGA). The presumptive attPcore site was located 74 nts from the terminus… read more here.

Keywords: recognition particle; rna component; site; attachment ... See more keywords

Telomerase RNA component knockout exacerbates Staphylococcus aureus pneumonia by extensive inflammation and dysfunction of T cells

Sign Up to like & get
recommendations!
Published in 2024 at "eLife"

DOI: 10.7554/elife.100433

Abstract: The telomerase RNA component (Terc) constitutes a non-coding RNA critical for telomerase function, commonly associated with aging and pivotal in immunomodulation during inflammation. Our study unveils heightened susceptibility to pneumonia caused by Staphylococcus aureus (S.… read more here.

Keywords: telomerase rna; rna component; knockout; terc ... See more keywords