Discovering New G-Quadruplex DNA Catalysts in Enantioselective Sulfoxidation Reaction
Sign Up to like & getrecommendations! Published in 2022 at "International Journal of Molecular Sciences"
DOI: 10.3390/ijms23031092
Abstract: The natural human telomeric G-quadruplex (G4) sequence d(GGGTTAGGGTTAGGGTTAGGG) HT21 was extensively utilized as a G4 DNA-based catalytic system for enantioselective reactions. Nine oligonucleotides (ODNs) based on this sequence and containing 8-bromo-2′-deoxyadenosine (ABr), 8-oxo-2′-deoxyadenosine (Aoxo) or… read more here.
Keywords: dna; enantioselective sulfoxidation; reaction; sulfoxidation reaction ... See more keywords